Ce mardi 6 septembre, un superbe meetup MySQL c’est déroulé à Paris dans les locaux d’ Executive MBA Epitech à Paris. Organisé et sponsorisé par Oracle MySQL et Openska. Un grand merci à tous les participants, aux organisateurs et au sponsor (Oracle). Merci également à Frédéric (EMEA MySQL Community Manager) et à Dimitri (MySQL Performance Architect). Vous pouvez récupérer les présentations sur […]
« Précédent 10 Nouvelles entrées | Suivant 10 Entrées plus anciennes »
Oracle MySQL, Openska et Executive MBA Epitech ont le plaisir de vous inviter le mardi 6 septembre pour le premier meetup MySQL de la rentrée. Au programme: MySQL Group Replication & MySQL as a Document Store
What’s up?
As you can see, Freewill now supports 17 different selection policies. At this point, all of them are coded but only half of them have been tested.
The 11 available termination policies are coded, half of them tested.
So far, only 2 mutation policies are available. Both of them are coded and tested. I will probably need a few extras for TSP type of problems as well as numerically parametrized problems (e.g. De Jong functions with a domain for each variable). I’ll probably add 3-4 other ones specific to the problem that started all this adventure!
Only one immigration policy (no immigration!) is available and it will stay that way …
[Lire plus]Note: this article was originally posted in French here.
You! Yes! Yep, you! I’m talking to you my friend! You, the one that I help out in forums, on IRC, on mailing lists!
Each and every day, I answer questions related to MySQL, mostly about SQL queries or optimization problems. Whether it’s on dBForums, Stack Overflow, MySQL.com, developpez.net or on IRC (irc.freenode.net, channel #mysql), it’s always the same thing! If you want me to help you, make it easy for me!
So, here’s a quick guide explaining what you have to do if …
[Lire plus]This was originally posted in French here.
There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string. For example, how many times does « abc » appear in « abcbcbabcbacbcabcababcabacb » ?
I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :
ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT
Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?
Luckily, the answer is yes! The solution is simple and looks like …
[Lire plus]What’s new?
After a major data loss (I haven’t given up on getting back all my data, mostly code repositories and databases!), I had to start all my pet projects from scratch. Luckily, it’s easier second time around as they say! And, lucky me, I store all my personal stuff on the web! So here’s a list of what’s coming up on this blog.
Ruzzle
Even though I had a decent working version of the genetic algorithm program to find the best ruzzle grid (original posts in French here, here and here), I wasn’t satisfied with the code. It slowly evolved from a bunch of code …
[Lire plus]Oracle MySQL Tech Tour
Date : mardi 10 mai 2016
Lieu : Remix Coworking - 24 cour des Petites Ecuries 75010
Horaire : 14:00 - 17:15
A partir de MySQL 5.7.12, la nouvelle version de la base de données la plus populaire, Les devs and DBAs peuvent maintenant déployer des bases MySQL qui implémentent un modèle document store, relationnel ou hybride (document ET relationnel) ! Plus d'info: http://dev.mysql.com/doc/refman/5.7/en/document-store.ht
Oui! Toi mon ami! Oui! Toi! C’est à toi que je m’adresse! Celui que je dépanne et que j’aide « gratis » à chaque jour!
Je réponds quotidiennement à des questions au sujet de MySQL, principalement de requêtes et d’optimisation. Que ce soit sur dBForums, Stack Overflow, MySQL.com, developpez.net ou sur IRC (irc.freenode.net, channel #mysql), c’est toujours la même chose. Si tu veux que je t’aide, aide-moi à t’aider!
Donc, un petit guide de ce qu’il faut faire pour qu’on puisse résoudre ton problème le plus rapidement possible.
Explique ton problème clairement
Si tu es …
[Lire plus]Parfois des requêtes problématiques tournent sur le serveur, mais il n'est pas possible de régler le problème à la source (Requêtes venant d'un ORM par example)
MySQL 5.7 fournit une API pre et post parse query rewrite. Les utilisateurs peuvent écrire leurs propre plugins ce qui permet d'éliminer le besoin d'un proxy. Avec le post-parse query plugin, il est possible de réécrire une requête problématique sans faire de changement au niveau de l'application, d'ajouter des hints pour les index ou pour l'optimiseur, de modifier l'ordre des jointures...
« Précédent 10 Nouvelles entrées | Suivant 10 Entrées plus anciennes »