Showing entries 1 to 10 of 11
Suivant 1 Entrées plus anciennes »
Displaying posts with tag: bases de données (reset)
MySQL : quelques lectures

Vous cherchez des solutions à des problèmes 1000 fois rencontrés?  Il y a de grandes chances que vous trouviez ce qu’il vous faut ici!

Un excellent blogue consacré à MySQL sur lequel je suis tombé par hasard, lefred.be.

Un article portant sur l’erreur 1215 (« Cannot add foreign key constraint« ).

Les InnoDB Page merge & split expliqués en détail dans ce billet.

[Lire plus]
The order of indexes

If you thought all you had to do was to declare a few indexes here and there and MySQL would magically be fast, you’ll be surprised reading this excellent article.


Classé dans:bases de données, database, MySQL, programming Tagged: index, MySQL, …

[Lire plus]
Count occurrences of a string using MySQL

This was originally posted in French here.

There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string.  For example, how many times does « abc »  appear in « abcbcbabcbacbcabcababcabacb » ?

I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :

ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT

Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?

Luckily, the answer is yes!  The solution is simple and looks like …

[Lire plus]
MySQL en vrac (5)

Un sondage sur le déploiment et la gestion de bases de données open source ici.

On vous demande votre utilisation des SQL Modes ici.

Une présentation sur PERFORMANCE_SCHEMA.

La taille du buffer pool : quelques précisions ici.

L’allocation de mémoire des buffers pour le performance schema dans MySQL 5.7 : quelques …

[Lire plus]
Les casse-tête

Ceux qui me connaissent bien le savent, j’adore me casser la tête sur une foule de « petits » problèmes (mathématiques, algorithmiques ou autres) : ça permet de garder le cerveau en forme et ça me donne une occasion de faire du Smalltalk et de me garder à jour dans mes skills autant de programmation que d’analyse.

Si vous êtes comme moi, voici une liste de ces petits casse-tête qui m’amusent en ce moment (ou depuis un bout) et qui pourrait vous servir de suggestions…

Les nombres de Lychrel

Avant tout, un peu de vocabulaire!

Un palindrome est une mot, une phrase ou un nombre qui s’écrit de la même façon à l’endroit et à l’envers.  Par exemple, Laval, Bob ou 17371.  Ça peut également être une phrase ou un bout de texte comme « Mon nom » ou le célèbre …

[Lire plus]
MySQL, PostgreSQL et optimisation

Un eBook gratuit: Practical Guide to Query Optimization for MySQL and PostgreSQL.


Classé dans:bases de données, MySQL, PostgreSQL Tagged: base de données, eBook, gratuit, …

[Lire plus]
Ressources MySQL gratuites

Quelques ressources gratuites vous permettant d’expérimenter avec MySQL.

db4free.net : un service vous offrant 1 base de données (MySQL 5.6) limitée à 100Mb de données.

SQL Fiddle : un outil vous permettant de tester vos requêtes SQL et vos définitions de schéma sur différents SGBD (Oracle, PostgreSQL, SQLite, MS Server, MySQL) incluant quelques versions de MySQL (5.1, 5.5, 5.6)

FreeMySQL.org : si l’on se fie au numéro de téléphone publié dans la section « Contact Us« , il s’agit d’une entreprise montréalaise!  Aucune limite quant à la taille de la base de donnée (en autant que vous ne monopolisez pas le CPU et l’espace disque du serveur…  Soyez donc raisonnables!).

[Lire plus]
Comment presser un citron (troisième partie)

1. Un problème n’arrive jamais seul

Dans la deuxième partie de cet article (le premier article étant ici), nous nous sommes laissés sur un exemple extrême (i.e. une grille avec des lignes et des colonnes vides) afin de vérifier la validité et l’efficacité de la solution présentée dans un des pires scénarios envisageable :

Avant même de débuter, rappelez-vous qu’il est primordial d’exécuter la commande suivante dans votre session pour éviter d’avoir à attendre une éternité, que ce soit pour la …

[Lire plus]
DataCleaner

DataCleaner est un outil d’analyse de données versatile, complet et efficace.  Il vous permet d’analyser, de nettoyer, de transformer et de profiler le contenu des tables de vos bases de données.

La version 3.0 de DataCleaner supporte les bases de données suivantes :

  • Apache Derby
  • Cubrid
  • DB2
  • Firebird
  • H2
  • Hsqldb
  • HyperSQL
  • Ingres
  • JDBC/ODBC
  • LucidDB
  • SQL Server
  • MySQL
  • Oracle
  • Pentaho Data Integration
  • Pervasive
  • PostgreSQL
  • SAP DB
  • SQLite
  • Sybase
  • Teradata

Vous pouvez également installer d’autres pilotes JDBC si besoin est et que la base de données que vous utilisez n’est pas dans la liste ci-haut ! …

[Lire plus]
2 petits outils pratiques pour MySQL

Je suis tombé par hasard sur un excellent blogue (en anglais malheureusement), Fatal Exception, principalement dédié à MySQL et qui explique en détail 2 procédures stockées qui pourraient grandement vous faciliter la tâche.

La première sert d’alternative à la commande SHOW TABLE STATUS en étant plus détaillé et plus lisible.

La seconde  permet d’avoir une vue d’ensemble de toutes les bases de …

[Lire plus]
Showing entries 1 to 10 of 11
Suivant 1 Entrées plus anciennes »