Showing entries 1 to 10 of 15
Suivant 5 Entrées plus anciennes »
Displaying posts with tag: bases de données (reset)
Le blogue de Jean-François Gagné

Si vous utilisez MySQL de façon intensive, le blogue de Jean-François Gagné est un incontournable!


Classé dans:bases de données, MySQL Tagged: MySQL

Trucs et astuces pour MySQL

Une page où vous pourrez avoir réponse à presque toutes vos questions concernant MySQL!


Classé dans:bases de données, MySQL Tagged: InnoDb, MyISAM, MySQL, snippets, tips

[Lire plus]
MySQL 8.0 : quelques améliorations

Pour ne nommer que deux améliorations dans MySQL 8.0, il y a les rôles (A quick tour of MySQL 8.0 roles) et des changements majeurs concernant les tablespaces (One Million Tables in MySQL 8.0).

 


Classé dans:bases de données, MySQL Tagged: 8.0, MySQL, roles, …

[Lire plus]
Des requêtes à problèmes?

Quand MySQL se me à déraper, c’est habituellement l’oeuvre de quelques requêtes SQL problématiques.  Un petit rappel pour vous aider à trouver la/les coupables!


Classé dans:bases de données, informatique, MySQL, optimisation, SQL Tagged: MySQL, …

[Lire plus]
MySQL : quelques lectures

Vous cherchez des solutions à des problèmes 1000 fois rencontrés?  Il y a de grandes chances que vous trouviez ce qu’il vous faut ici!

Un excellent blogue consacré à MySQL sur lequel je suis tombé par hasard, lefred.be.

Un article portant sur l’erreur 1215 (« Cannot add foreign key constraint« ).

Les InnoDB Page merge & split expliqués en détail dans ce billet.

[Lire plus]
The order of indexes

If you thought all you had to do was to declare a few indexes here and there and MySQL would magically be fast, you’ll be surprised reading this excellent article.


Classé dans:bases de données, database, MySQL, programming Tagged: index, MySQL, …

[Lire plus]
Count occurrences of a string using MySQL

This was originally posted in French here.

There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string.  For example, how many times does « abc »  appear in « abcbcbabcbacbcabcababcabacb » ?

I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :

ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT

Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?

Luckily, the answer is yes!  The solution is simple and looks like …

[Lire plus]
MySQL en vrac (5)

Un sondage sur le déploiment et la gestion de bases de données open source ici.

On vous demande votre utilisation des SQL Modes ici.

Une présentation sur PERFORMANCE_SCHEMA.

La taille du buffer pool : quelques précisions ici.

L’allocation de mémoire des buffers pour le performance schema dans MySQL 5.7 : quelques …

[Lire plus]
Les casse-tête

Ceux qui me connaissent bien le savent, j’adore me casser la tête sur une foule de « petits » problèmes (mathématiques, algorithmiques ou autres) : ça permet de garder le cerveau en forme et ça me donne une occasion de faire du Smalltalk et de me garder à jour dans mes skills autant de programmation que d’analyse.

Si vous êtes comme moi, voici une liste de ces petits casse-tête qui m’amusent en ce moment (ou depuis un bout) et qui pourrait vous servir de suggestions…

Les nombres de Lychrel

Avant tout, un peu de vocabulaire!

Un palindrome est une mot, une phrase ou un nombre qui s’écrit de la même façon à l’endroit et à l’envers.  Par exemple, Laval, Bob ou 17371.  Ça peut également être une phrase ou un bout de texte comme « Mon nom » ou le célèbre …

[Lire plus]
MySQL, PostgreSQL et optimisation

Un eBook gratuit: Practical Guide to Query Optimization for MySQL and PostgreSQL.


Classé dans:bases de données, MySQL, PostgreSQL Tagged: base de données, eBook, gratuit, …

[Lire plus]
Showing entries 1 to 10 of 15
Suivant 5 Entrées plus anciennes »