Showing entries 1 to 3
Displaying posts with tag: occurrences (reset)
occurrencesOf

Comment trouver le nombre d’occurrences d’une chaîne de caractères dans MySQL?  J’en avais déjà parlé ici en français et aussi en anglais.

Pour se faciliter la vie, rien de mieux qu’une fonction pour faire le travail!

 

SET @OLD_SQL_MODE=@@SQL_MODE, SQL_MODE='STRICT_TRANS_TABLES';

DROP FUNCTION IF EXISTS occurrencesOf;

DELIMITER //
CREATE FUNCTION occurrencesOf ( sourceString VARBINARY(255), searchString VARBINARY(255))
RETURNS MEDIUMINT UNSIGNED
DETERMINISTIC
LANGUAGE SQL
CONTAINS SQL
SQL SECURITY DEFINER
COMMENT 'Returns the number of occurrences of <searchString> inside <sourceString>'

BEGIN
DECLARE occ MEDIUMINT UNSIGNED; …
[Lire plus]
Count occurrences of a string using MySQL

This was originally posted in French here.

There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string.  For example, how many times does « abc »  appear in « abcbcbabcbacbcabcababcabacb » ?

I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :

ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT

Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?

Luckily, the answer is yes!  The solution is simple and looks like …

[Lire plus]
Comment trouver le nombre d’occurrences d’une chaîne de caractères dans MySQL?

Il n’existe pas de fonction dans MySQL  (et bien d’autres SGBD) pour trouver le nombre d’occurrences d’une chaîne de caractères dans une autre.  Par exemple, combien de fois « ait » apparaît dans la chaîne « Il était grand mais il avait peur » ?

Ou, comme on me l’a récemment demandé sur IRC, vous cherchez à déterminer le nombre d’occurrences d’une sous-séquence particulière (par exemple, « TAT ») dans la séquence génomique suivante :

ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT

Évidemment, vous pouvez lire les données du SGBD puis faire la recherche en mémoire en utilisant votre langage de programmation préféré mais comment faire le tout en SQL ?

La solution est simple et elle a la forme suivante :


SELECT FLOOR(( LENGTH(source) - LENGTH(REPLACE(source, chaineAChercher, '')) ) / (LENGTH(chaineAChercher))) as occ …
[Lire plus]
Showing entries 1 to 3