If you thought all you had to do was to declare a few indexes here and there and MySQL would magically be fast, you’ll be surprised reading this excellent article.

Classé dans:bases de données, database, MySQL, programming Tagged: index, MySQL, …

(Click to enlarge)

What’s up?

As you can see, Freewill now supports 17 different selection policies.  At this point, all of them are coded but only half of them have been tested.

The 11 available termination policies are coded, half of them tested.

So far, only 2 mutation policies are available.  Both of them are coded and tested. I will probably need a few extras for TSP type of problems as well as numerically parametrized problems (e.g. De Jong functions with a domain for each variable).  I’ll probably add 3-4 other ones specific to the problem that started all this adventure!

Only one immigration policy (no immigration!) is available and it will stay that way …

This was originally posted in French here.

There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string.  For example, how many times does « abc »  appear in « abcbcbabcbacbcabcababcabacb » ?

I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :

ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT

Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?

Luckily, the answer is yes!  The solution is simple and looks like …