Showing entries 1 to 10 of 422
Suivant 10 Entrées plus anciennes »
Displaying posts with tag: MySQL (reset)
MySQL : quelques lectures

Vous cherchez des solutions à des problèmes 1000 fois rencontrés?  Il y a de grandes chances que vous trouviez ce qu’il vous faut ici!

Un excellent blogue consacré à MySQL sur lequel je suis tombé par hasard, lefred.be.

Un article portant sur l’erreur 1215 (« Cannot add foreign key constraint« ).

Les InnoDB Page merge & split expliqués en détail dans ce billet.

[Lire plus]
Les plaques du Congo

Comment générer une clef séquentielle et incrémentale composée d’une partie numérique et d’un suffixe lettré?

Comme c’est une situation souvent rencontrée et que les gens détestent habituellement s’attaquer aux procédures stockées et/ou évitent d’utiliser leur langage de programmation favori (pour avoir une solution à 100% en SQL), j’ai pensé vous montrer le problème qu’on m’a demandé de résoudre en SQL et ma solution (qui peut facilement être adaptée aux problèmes similaires)…

Dans le cas qui nous intéresse, il s’agit de plaques d’immatriculation de la République du Congo (format CEMAC).


/*
En supposant la définition suivante

CREATE TABLE plaques(plaque VARCHAR(10));

Et le format de plaque …
[Lire plus]
The order of indexes

If you thought all you had to do was to declare a few indexes here and there and MySQL would magically be fast, you’ll be surprised reading this excellent article.


Classé dans:bases de données, database, MySQL, programming Tagged: index, MySQL, …

[Lire plus]
MySQL and UUID

MySQL 8.0.0 has a few new UUID functions!  Read all about this here!


Classé dans:MySQL Tagged: functions, MySQL, UUID

InnoDb variables

Sure, there are tools and script to help you fine tune your MySQL server but there’s nothing like using your brain.

Pythian has done a wonderful job of explaining what all those InnoDb-related variables in a series of articles…

Exposing Innodb Internals via System Variables: Part 1, Memory
Exposing Innodb Internals via System Variables: Part 2, I/O (structure and logs)
Exposing Innodb Internals via System Variables: Part 3, I/O (Table data)

[Lire plus]
Retour sur le meetup – MySQL Group Replication & MySQL as a Document Store

Ce mardi 6 septembre, un superbe meetup MySQL  c’est déroulé à Paris dans les locaux d’ Executive MBA Epitech  à Paris. Organisé et sponsorisé par  Oracle MySQL et Openska. Un grand merci à tous les participants, aux organisateurs et au sponsor (Oracle). Merci également à Frédéric (EMEA MySQL Community Manager) et à Dimitri (MySQL Performance Architect). Vous pouvez récupérer les présentations sur […]

Meetup – MySQL Group Replication & MySQL as a Document Store

Oracle MySQL, Openska et Executive MBA Epitech ont le plaisir de vous inviter le mardi 6 septembre pour le premier meetup MySQL de la rentrée. Au programme: MySQL Group Replication & MySQL as a Document Store

Freewill in progress (2)

(Click to enlarge)

What’s up?

As you can see, Freewill now supports 17 different selection policies.  At this point, all of them are coded but only half of them have been tested.

The 11 available termination policies are coded, half of them tested.

So far, only 2 mutation policies are available.  Both of them are coded and tested. I will probably need a few extras for TSP type of problems as well as numerically parametrized problems (e.g. De Jong functions with a domain for each variable).  I’ll probably add 3-4 other ones specific to the problem that started all this adventure!

Only one immigration policy (no immigration!) is available and it will stay that way …

[Lire plus]
Quick Guide On How To Ask A MySQL-related Question Properly

Note: this article was originally posted in French here.

You!  Yes!  Yep, you! I’m talking to you my friend!  You, the one that I help out in forums, on IRC, on mailing lists!

Each and every day, I answer questions related to MySQL, mostly about SQL queries or optimization problems. Whether it’s on dBForums, Stack Overflow, MySQL.com, developpez.net or on IRC (irc.freenode.net, channel #mysql), it’s always the same thing! If you want me to help you, make it easy for me!

So, here’s a quick guide explaining what you have to do if …

[Lire plus]
Count occurrences of a string using MySQL

This was originally posted in French here.

There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string.  For example, how many times does « abc »  appear in « abcbcbabcbacbcabcababcabacb » ?

I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :

ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT

Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?

Luckily, the answer is yes!  The solution is simple and looks like …

[Lire plus]
Showing entries 1 to 10 of 422
Suivant 10 Entrées plus anciennes »