This was originally posted in French here.

There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string.  For example, how many times does « abc »  appear in « abcbcbabcbacbcabcababcabacb » ?

I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :

ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT

Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?

Luckily, the answer is yes!  The solution is simple and looks like …